Temperature-dependent Conformational Changes in Single-Stranded DNA (ssDNA)

Abstract

Single-stranded DNA (ssDNA) exhibits remarkable flexibility and dynamic behavior, making it highly sensitive to environmental conditions such as temperature and ionic strength. In this study, we employed coarse-grained modeling using the oxDNA framework to investigate the temperature-dependent conformational changes of a 100-base ssDNA sequence with the sequence 5′TAAGAAGTTTCCACTGATCGGGTGATGCCGGGCACGACTGGGTTTATGCCAACCGGTCCCCTAATGAGTGGCCAACCTTGGCGTGGGATTATCGCACATA3′ under two salt concentrations (0.5 M and 1 M). Our simulations, conducted over a temperature range of 27°C to 100°C, reveal that ssDNA undergoes significant structural transitions as temperature increases. At lower temperatures, ssDNA adopts stable secondary structures such as hairpins and loops, stabilized by base stacking and hydrogen bonding. As temperature rises, these structures unravel, leading to a transition toward random coil conformations. We observed a complex interplay between length and diameter changes, with ssDNA initially expanding in diameter while shortening in length, followed by elongation and eventual dramatic expansion at higher temperatures. These findings align with thermodynamic principles, particularly the Peyrard-Bishop model, and highlight the role of thermal energy in disrupting base stacking interactions. Our results provide insights into the conformational dynamics of ssDNA under varying thermal and ionic conditions, with implications for its biological functions and stability.